Skip to main content

Table 2 Primers used for mitochondrial DNA copy number measurement in piglet ileum and liver

From: Neonatal diet impacts liver mitochondrial bioenergetics in piglets fed formula or human milk

Gene Forward Primer 5′-3’ Reverse Primer 5′-3’ Amplicon (bp) Use
Cox1 CTCTGGGCTTCATCTTCCTATTC GAGGACATCCGTGTAGTCATTC 477 Standard Curve
Nd1 GCCTAGCAGTATACTCTATCCT CGTATCGGAATCGTGGGTATG 519 Standard Curve
Actb CTGGCATTGTCATGGACTCT GATCGAGTTGAAGGTGGTCTC 496 Standard Curve
Cox1 GTAGTCGCACACTTCCACTATG TGAGTGTGTACCCGGAGAATA 100 Real-time PCR
Nd1 TTATCTCAACCCTAGCAGAAACC AAAGGTCCGGCTGCATATT 103 Real-time PCR
Actb ACCTGACCGACTACCTCAT GCAGAGCTTCTCCTTGATGT 101 Real-time PCR