Skip to main content

Table 3 Primers used for mitochondrial gene expression assays in piglet ileum and liver

From: Neonatal diet impacts liver mitochondrial bioenergetics in piglets fed formula or human milk

Gene Forward Primer 5′- 3’ Reverse Primer 5′- 3’
Cycs CCAAACCTCCATGGTCTCTTT TACTCCATCAGTGTCTCCTCTC
Hspa9 TCAACAGGAACACCACCATT TCTCTCTCACCCTGACATACTT
Nrf1 CGATGGCACTGTCTCTCTTATC CCATCAGCCACAGCAGAATA
p53 CCGAGTACTTGGATGACAGAAA GTTGTAGTGGATGGTGGTACAG
Pgc1α CCCACAACTCCTCCTCATAAAG TCACTGTACCGGGTCTTCT
Pparβ CATGAAGCTGGAGTACGAGAAG AGCGAATGGCGTTGTAAGA
Sco2 AAGGACGAGGACCAGGATTA TGCCGTAGTAGTCGGTGAA
Tfam GTGGAGGGAACTTCCTGATTC TGACTTGGAGTTAGCTGTTCTT
Trap1 CAGCTTCGACCACCTCTTC CCAGCAGCCCATCCTTATT
Uqcr10 GAGGTTGTACTCCCTGTTGTTT CCTGGTTGATGTGTTCGTAGAT
Rps16 TGATCCTCGTCGCTGTGAATCCAA ACGCTGATCATCACGATGGGCTTA
Rpl27 AAGTTCATGAAACCCGGGAAGGTG TCGGTCTGAGGTGCCATCATCAAT
18S CCTGTAATTGGAATGAGTCCAATTT ATACGCTATTGGAGCTGGAATTACC