Skip to main content

Table 1 PCR primers used for the quantification of miRs in human plasma

From: Preliminary evidence that lectins in infant soy formula apparently bind bovine milk exosomes and prevent their absorption in healthy adults

Amplicon Forward Primer
miSPIKE CTCAGGATGGCGGAGCGGTCT
miR-1 TGGAATGTAAAGAAGTATGTAT
miR-15b TAGCACATCATGGTTTACA
miR-34a-5p TGGCAGTGTCTTAGCTGGTTGT
miR-106b TAAAGTGCTGACAGTGCAGAT
miR-155 TTAATGCTAATCGTGATAGGGGT
miR-21-5p GCTAGCTTATCAGACTGATGTTGA
miR-223 CTGTCAGTTTGTCAAATACCCCA